arthropods

Pollinator Survey in Creosote Shrubland at the Sevilleta National Wildlife Refuge, New Mexico

Abstract: 

Larrea tridentata (Creosote Shrub) is a generalist plant that provides floral resources in the form of nectar and pollen to a wide variety of bee species. The aim of this study is to evaluate the extent of this interaction at the Sevilleta Creosote Shrubland. Specifically, bee individuals directly interacting with L. tridentata were captured in order to give an accurate description of the number of species dependent on Creosote for resources. 

Core Areas: 

Data set ID: 

296

Keywords: 

Data sources: 

sev296_beesurvey_20150304.csv

Keystone species have large impacts on community and ecosystem properties, and create important ecological interactions with other species.  Prairie dogs (Cynomys spp.) and banner-tailed kangaroo rats (Dipodomys spectabilis) are considered keystone species of grassland ecosystems, and create a mosaic of unique habitats on the landscape.

Pino Gate Prairie Dog Study: Landscape-scale Grasshopper Plot Data from the Sevilleta National Wildlife Refuge, New Mexico (2000-2002)

Abstract: 

Keystone species have large impacts on community and ecosystem properties, and create important ecological interactions with other species. Prairie dogs (Cynomys spp.) and banner-tailed kangaroo rats (Dipodomys spectabilis) are considered keystone species of grassland ecosystems, and create a mosaic of unique habitats on the landscape. These habitats are known to attract a number of animal species, but little is known about how they affect arthropod communities. Our research evaluated the keystone roles of prairie dogs and kangaroo rats on arthropods at the Sevilleta National Wildlife Refuge in central New Mexico, USA. We evaluated the impacts of these rodents on ground-dwelling arthropod and grasshopper communities in areas where prairie dogs and kangaroo rats co-occurred compared to areas where each rodent species occurred alone. Our results demonstrate that prairie dogs and kangaroo rats have keystone-level impacts on these arthropod communities. Their burrow systems provided important habitats for multiple trophic and taxonomic groups of arthropods, and increased overall arthropod abundance and species richness on the landscape. any arthropods also were attracted to the aboveground habitats around the mounds and across the landscapes where the rodents occurred. Detritivores, predators, ants, grasshoppers, and rare rodent burrow inhabitants showed the strongest responses to prairie dog and kangaroo rat activity. The impacts of prairie dogs and kangaroo rats were unique, and the habitats they created supported different assemblages of arthropods. Where both rodent species occurred together on the landscape, there was greater habitat heterogeneity and increased arthropod diversity.

Core Areas: 

Data set ID: 

197

Additional Project roles: 

350

Keywords: 

Data sources: 

sev197_pdoghopperplot_01142009.txt

Methods: 

Experimental Design

Landscape-scale plots: We compared grasshoppers on plots occupied by:1) both species (Pdog+Krat plot);2) only kangaroo rats (Krat plot); and 3) both species, but where prairie dogs inhabited one half of the plot and kangaroo rats inhabited the other half (Transition plot).

Sampling Design

The landscape-scale plots were 180 m x 180 m. Grasshoppers were visually sampled along strip  transect lines established along each gridline of the landscape-scale plots, using a 5 x 5 grid array. Strip transects on the landscape-scale plots measured 1 m x 30 m.

Field methods

Grasshoppers were sampled by walking slowly along each transect,tapping the soil and vegetation with a 1 m long, 1.27 cm diameter white PVC pipe. Grasshoppers flushed from the ground were counted and identified to species, and the substrate (i.e., plant species, bare soil) they were  observed on was recorded. This is the standard method used at both the SEV and Jornada LTER sites, and is similar to that developed by Paftd (1982). Grasshoppers were sampled during spring (April) and fall (September), from fall 1999 through spring 2002 at the SNWR.

Laboratory Procedures

Grasshopper voucher specimens from this study were deposited in the collection of the Arthropod Division, Museum of Southwestern Biology at the University of New Mexico.

Maintenance: 

01/09/2009 (YX): the metadata was entered from metadata supplied by Ana Davidson 1/25/2008

(Yang Xia) - updated and modified metadata to correct format;checked data for missing data points and
errors;- any empty cells were filled in with either -999 for missing data

Additional information: 

Additional Personnel with Data Collection

Julie McIntyre was part of the field crew in collecting/processing samples.

Additional Study Area Information

Study Area Name: Pino Gate

Study Area Location: The study site was located near the base of the Los Pinos mountains and directly adjacent to the nothern fencline of the SNWR at Pino Gate.

Elevation: 1600 m

Vegetation: Burrograss (Scleropogon brevifolius), sand dropseed (Sporobolus cryptandrus), and black grama (Bouteloua eriopoda) were the dominant vegetation.

Soils: Deep clayey loam soils

Geology: On an upper bajada slope, in a broad swale

Climate: Long-term mean annual precipitation is 243 mm, about 60% of which occurs during the summer. Long-term mean monthly temperatures for January and July are 1.5°C and 25.1°C, respectively.

Site history: Historically, prairie dogs were common throughout the area, but were exterminated by the early 1970’s (John Ford, United States Department of Agriculture Wildlife Services, personal communication). Gunnison’s prairie dogs began to re-colonize the study site from adjacent private land in 1998. During our study, the colony occurred within a 5 ha area, near the base of the Los Piños Mountains in an area with deep clayey loam soils. The site has been long inhabited by kangaroo rats, and represents typical northern Chihuahuan Desert grassland

North Coordinate:34.406954
South Coordinate:34.406954
East Coordinate:106.606269
West Coordinate:106.606269

Ground Arthropod Community Survey in Grassland, Shrubland, and Woodland at the Sevilleta National Wildlife Refuge, New Mexico (1992-2004)

Abstract: 

This data set contains records for the numbers of selected groups of ground-dwelling arthropod species and individuals collected from pitfall traps at 4 sites on the Sevilleta NWR, including creotostebush shrubland, both black and blue grama grasslands, and a pinyon/juniper woodland. Data collections begin in May of 1989, and are represented by subsequent sample collections every 2 months. One site (Goat Draw/Cerro Montosa) was discontinued in 2001, and a new site (Blue Grama) was initiated . Only three sites, creosotebush, black grama, and blue grama were continued between 2001-2004.

Core Areas: 

Data set ID: 

29

Additional Project roles: 

332
333
334
335

Keywords: 

Purpose: 

To monitor the species composition and relative abundance's of select ground dwelling arthropod taxa and trophic groups from principal long-term study sites/environments in relation to climate change and plant production. 

Data sources: 

sev029_arthropop_02162009

Methods: 

Experimental Design

Arthropods have been collected from four subjectively chosen sites on the Sevilleta National Wildlife Refuge (SNWR), representing the following habitat types:  pinyon-juniper (elev. 2195 m), black grama grassland, blue grama grassland, and creosotebush shrubland (elev. ~1400 m for all three). At each of the four sites there were 30 traps arranged in five replicate lines with six traps per line.  Each line was located outside a mammal trapping web, except at Goat Draw, where mammal trapping webs were installed three years after the arthropod traps.  In 1995 Robert Parmenter and Sandra Brantley decided to reduce the number of traps by half.  Comparative statistical tests run with data from 15 traps showed no difference in mean abundances of dominant species compared to tests with 30 traps. The interannual variability is high and it is hoped that the long-term aspect of the monitoring will produce clearer patterns than intensive sampling over a short period has done.  Traps 1, 3 and 5 were left and traps 2, 4 and 6 were removed.  The decision was also made to process samples from only the odd-numbered traps beginning with the 1993 samples. The experimental design was intended to provide data for long-term monitoring of ground arthropods in relation to climate and plant production. The traps within each trap line are subsamples, and data from those should be summed or averaged for a single value per line, per sample period. The lines are intended to serve as replicate samples for each habitat site, however, they were not randomly located. The lines were located to provide a systematic array with trap lines approximately 200 meters from each other on the landscape.

Field Methods

During a collection period the contents of each trap are strained out of the glycol so that it can be reused.  Glycol is replenished as needed to keep the cups about half full.  Arthropods are transferred from the strainers to glass vials containing site labels.  The contents of each trap are stored in a separate vial. Trap condition forms are filled out at the time of collection and kept with the samples. Any traps that are damaged or not functioning are re-set.

Sampling Design

Arthropods are collected in pitfall traps, made of a 15 oz. can (11 cm tall and 7.5 cm in diameter) dug into the ground so that the opening of the can is flush with the ground. A screen apron was fitted around the top of the can to prevent rodent digging. Plastic 10 oz. cups about half-full of propylene glycol (ethylene glycol prior to March 1994) are inserted in the can.  The glycol is a preservative; no live pitfall trapping of arthropods is done.  The traps are covered by raised ceramic lids, 15 cm x 15 cm in size.  The traps remain open all year, and samples are collected everly two months during the week of the 15th day of each months, for the months: February, April, Jun, August, October, and December.During a collection period the contents of each trap are strained out of the glycol so that it can be reused, using standard hand-held metal screen kitchen strainers approximately 3 inches diameter.  Glycol is replenished as needed to keep the cups about half full.  Arthropods are transferred from the strainers to glass vials containing site labels.  The contents of each trap are stored in a separate vial. Trap condition forms are filled out at the time of collection and kept with  the samples.

Laboratory Procedures

Specimens are stored in 70 % ethanol. Specimens are brought back to the UNM Museum of Southwestern Biology (MSB) wet lab for processing. Sample sorting, arthropod identification, and data tabulation are performed only by individuals trained as entomologists, or entomologically experienced graduate students trained in arthropod identification specifically for this project.  Individual arthropods are identified to morphospecies and counted.  Classifications generally follow Nomina Insecta Nearctica: a checklist of the insects of North America, Volumes 1-4, however, taxonomic levels above family follow Borror, DeLong and Triplehorn's An Introduction to Entomology, 5th edition.  Higher classification for Orthopteroids follow Arnett, 2000 (per DLC). And classification of Aranae follows Roth's Spider Genera of North America, 2nd and 3rd editions. The species code, number of individuals, site name and date of  collection are entered on a data sheet. After processing, all the samples from one site and date are pooled for long-term storage in sealed jars containing 70% ethanol, at the UNM Biology Field Station, located at the Sevilleta NWR.  Detailed procedures for sorting and identifying the arthropods are available from the Sevilleta data manager (data-use@sevilleta.unm.edu).  Reference collections are maintained at the Sevilleta Field Station and at the UNM Museum of Southwestern Biology Division of Arthropods. Voucher specimens are housed in the UNM MSB Division of Arthropods. 

Ground arthropod species in the following taxonomic groups are collected, counted and identified to morphospecies:-orthopterans, including grasshoppers, field crickets and camel crickets-blattarians, sand cockroaches-mantodeans, only ground mantids-phasmatodeans, walkingsticks-hemipterans, selected taxa only: lygaeids, alydids, one genus of mirid, thyreocorids, cydnids-coleopterans-microcoryphians, bristletails-chilopods-diplopods -isopods-arachnids, including spiders, scorpions, solpugids, uropygids, opiliones.

Specimens are pinned or placed in 70 % ETOH, labeled, and added to the LTER collection or to the UNM Division of Arthropods collection as needed.  If the specimens are not needed they are kept in alcohol storage and housed at the Sevilleta Field Station. See: /sevilleta/export/db/work/insect/specieslists/sevrefcoll for a list of specimens vouchered by the MSB. The focus of the pitfall collections is on the adult stage, but nymphs of orthopteroids and hemipterans and immature stages of arachnids are identified to genus or species if possible.  If not, these groups have species i.d. numbers for nymphal or immature stages. Larval beetles are not counted.  The aleocharine staphylinid species are grouped together under species number Co Sta 001 088.

Maintenance: 

January 2009Combined all data from 1992-2004. QA/QC'd data from 2001-2004 in excel using a filter and checking data line by line. All data were then imported into Navicat using the import wizard.

Data from 1989-1991 were removed and stored elsewhere. Contact data manager for data. --A.Swann

Additional information: 


Additional Information on the Data Collection Period

Field collections are made every even-numberedmonth as close to the 15th as possible. 

This study/data set is a subset of the original larger scale Sevilleta LTER data set #: SEV0029; "Arthropod Populations". The number of arthropod taxa included in this data set ("Sevilleta Ground Arthropods") has been reduced to those taxa that are appropriately sampled by pitfall traps, and those taxa or taxonmic ranks that can be easily identified and tabulated by expert technical staff. The number of study sites also was reduced from seven to four for this data set. Associated data sets include climate data from representative Sevilleta LTER meterological stations, and plant production data from Sevilleta LTER above ground net primary production plots, located on or near the arthropod pitfall trap sites.

Pino Gate Prairie Dog Study: Mound-scale Grasshopper Plot Data from the Sevilleta National Wildlife Refuge, New Mexico (2000-2001)

Abstract: 

Keystone species have large impacts on community and ecosystem properties, and create important ecological interactions with other species. Prairie dogs (Cynomys spp.) and banner-tailed kangaroo rats (Dipodomys spectabilis) are considered keystone species of grassland ecosystems, and create a mosaic of unique habitats on the landscape. These habitats are known to attract a number of animal species, but little is known about how they affect arthropod communities. Our research evaluated the keystone roles of prairie dogs and kangaroo rats on arthropods at the Sevilleta National Wildlife Refuge in central New Mexico, USA. We evaluated the impacts of these rodents on ground-dwelling arthropod and grasshopper communities in areas where prairie dogs and kangaroo rats co-occurred compared to areas where each rodent species occurred alone. Our results demonstrate that prairie dogs and kangaroo rats have keystone-level impacts on these arthropod communities. Their burrow systems provided important habitats for multiple trophic and taxonomic groups of arthropods, and increased overall arthropod abundance and species richness on the landscape. Many arthropods also were attracted to the aboveground habitats around the mounds and across the landscapes where the rodents occurred. Detritivores, predators, ants, grasshoppers, and rare rodent burrow inhabitants showed the strongest responses to prairie dog and kangaroo rat activity. The impacts of prairie dogs and kangaroo rats were unique, and the habitats they created supported different assemblages of arthropods. Where both rodent species occurred together on the landscape, there was greater habitat heterogeneity and increased arthropod diversity.

Core Areas: 

Data set ID: 

198

Additional Project roles: 

351

Keywords: 

Data sources: 

sev198_pdoghoppermound_01142009.txt

Methods: 

Experimental Design

Mound-scale plots- To evaluate arthropods associated with mound disturbance patches and rodent burrow systems, we established replicate mound-scale plots with paired “non-mound” control plots. The mound and non-mound plots were spatially intermixed within each landscape-scale plot. Samples were collected from 10 kangaroo rat mounds on the Krat plot, 10 prairie dog and 10 kangaroo rat mounds on the Pdog+Krat plot, and on paired non-mounds located 10 m away from sample mounds, in areas with minimal rodent disturbance.

Sampling Design

Grasshoppers were visually sampled along strip transect lines established through each mound-scale plot. Strip transects on the mound-scale plots measured 1 m x 5 m.

Field methods

Grasshoppers were sampled by walking slowly along each transect, tapping the soil and vegetation with a 1 m long, 1.27 cm diameter white PVC pipe. Grasshoppers flushed from the ground were counted and identified to species, and the substrate (i.e., plant species, bare soil) they were observed on was recorded. This is the standard method used at both the SEV and Jornada LTER sites, and is similar to that developed by Paftd (1982). Grasshoppers were sampled during spring (April) and fall (September), from fall 1999 through spring 2002 at the SNWR.

Laboratory Procedures

Grasshopper voucher specimens from this study were deposited in the collection of the Arthropod Division, Museum of Southwestern Biology at the University of New Mexico.

Maintenance: 

01/09/2009 (YX): the  metadata was entered  from metadata supplied by Ana Davidson

1/25/2008(YX):updated and modified metadata to correct format;checked data for missing data points and errors;- any empty cells were filled in with either -999 for missing data

Additional information: 

Additional Personnel involved in Data Collection

Julie McIntyre was part of the field crew in collecting and processing samples.

Additional Study Area Information

Study Area Name: Pino Gate

Study Area Location: The study site was located near the base of the Los Pinos mountains and directly adjacent to the nothern fencline of the SNWR at Pino Gate.

Elevation: 1600 m

Vegetation: Burrograss (Scleropogon brevifolius), sand dropseed (Sporobolus cryptandrus), and black grama (Bouteloua eriopoda) were the dominant vegetation.

Soils: Deep clayey loam soils.

Geology: On an upper bajada slope, in a broad swale.

Climate: Long-term mean annual precipitation is 243 mm, about 60% of which occurs during the summer. Long-term mean monthly temperatures for January and July are 1.5°C and 25.1°C, respectively.

Site history: Historically, prairie dogs were common throughout the area, but were exterminated by the early 1970’s (John Ford, United States Department of Agriculture Wildlife Services, personal communication). Gunnison’s prairie dogs began to re-colonize the study site from adjacent private land in 1998. During our study, the colony occurred within a 5 ha area, near the base of the Los Piños Mountains in an area with deep clayey loam soils. The site has been long inhabited by kangaroo rats, and represents typical northern Chihuahuan Desert grassland.

North Coordinate:34.406954
South Coordinate:34.406954
East Coordinate:106.606269
West Coordinate:106.606269

Pino Gate Prairie Dog Study: Mound-scale Ground-Dwelling Arthropod Plot Data from the Sevilleta National Wildlife Refuge, New Mexico (2000-2001)

Abstract: 

Keystone species have large impacts on community and ecosystem properties, and create important ecological interactions with other species. Prairie dogs (Cynomys spp.) and banner-tailed kangaroo rats (Dipodomys spectabilis) are considered keystone species of grassland ecosystems,and create a mosaic of unique habitats on the landscape. These habitats are known to attract a number of animal species, but little is known about how they affect arthropod communities. Our research evaluated the keystone roles of prairie dogs and kangaroo rats on arthropods at the Sevilleta National Wildlife Refuge in central New Mexico, USA. We evaluated the impacts of these rodents on ground-dwelling arthropod and grasshopper communities in areas where prairie dogs and kangaroo rats co-occurred compared to areas where each rodent species occurred alone. Our results demonstrate that prairie dogs and kangaroo rats have keystone-level impacts on these arthropod communities. Their burrow systems provided important habitats for multiple trophic and taxonomic groups of arthropods, and increased overall arthropod abundance and species richness on the landscape. Many arthropods also were attracted to the aboveground habitats around the mounds and across the landscapes where the rodents occurred. Detritivores, predators, ants, grasshoppers, and rare rodent burrow inhabitants showed the strongest responses to prairie dog and kangaroo rat activity. The impacts of prairie dogs and kangaroo rats were unique, and the habitats they created supported different assemblages of arthropods. Where both rodent species occurred together on the landscape, there was greater habitat heterogeneity and increased arthropod diversity. there was great habitat heterogeneity and increased arthropod diversity.

Core Areas: 

Data set ID: 

196

Additional Project roles: 

349

Keywords: 

Data sources: 

sev196_pdogarthromound_01132009.txt

Methods: 

Experimental Design

( Mound-scale plots) To evaluate arthropods associated with mound disturbance patches and rodent burrow systems, we established replicate mound-scale plots with paired non-mound control plots, a design similar to that used by Hawkins and Nicoletto (1992), Schooley et al. (2000), and others. The mound and non-mound plots were spatially intermixed within each landscape-scale plot. Samples were collected from 10 kangaroo rat mounds on the Krat plot, 10 prairie dog and 10 kangaroo rat mounds on the Pdog+Krat plot, and on paired non-mounds located 10 m away from sample mounds, in areas with minimal rodent disturbance.

Sampling Design

Pitfall traps also were placed next to prairie dog mounds and paired non-mounds on the Pdog+Krat plot and at kangaroo rat mounds and paired non-mounds on the Krat plot. To prevent rodents from disturbing the traps, pitfall traps at mound-scale plots were surrounded by 2.54 cm wire mesh, large enough to allow large arthropods to pass through.

Field methods

The pitfall traps were made of 10 oz plastic cups inserted into 12 oz cans, buried with the rim of the cup flush with the ground. Traps were filled with non-toxic propylene glycol as the trapping and preservation agent, and ceramic tiles (0.23 m x 0.23 m) were elevated over the traps. Traps were opened for one month, both during spring (May) and fall (September), from spring 2000 through fall 2001.

Laboratory Procedures

Arthropod samples were sorted and identified in the laboratory. Only ground-dwelling taxa were considered. The pitfall dataset resulted in 218 species (from both plot and mound samples). Most taxonomic groups were identified to species, but weevils (Curculionidae), velvet ants (Mutillidae), and spider wasps (Pompilidae) were grouped at higher taxonomic levels and not included in. Nymphs of crickets, grasshoppers, and spiders could not be identified to species. Arthropod voucher specimens from this study were deposited in the collection of the Arthropod Division, Museum of Southwestern Biology (MSB) at the University of New Mexico (UNM).

Maintenance: 

1/09/2009 -YX. The metadata was entered by Yang Xia from metadata supplied by Ana Davidson 1/17/2008 (Yang Xia) - updated and modified metadata to correct format; - Checked data for missing data points and errors

Additional information: 

Additional Personnel with Collecting Samples and Data

Julie McIntyre helped with the field data collection.

Additional Study Area Information

Study Area Name: Pino Gate

Study Area Location: The study site was located near the base of the Los Pinos mountains and directly adjacent to the nothern fenceline of the SNWR at Pino Gate.

Elevation: 1600 m

Vegetation: Burrograss (Scleropogon brevifolius), sand dropseed (Sporobolus cryptandrus), and black grama (Bouteloua eriopoda) were the dominant vegetation.

Soils: Deep clayey loam soils
 
Geology: On an upper bajada slope, in a broad swale

Climate: Long-term mean annual precipitation is 243 mm, about 60% of which occurs during the summer. Long-term mean monthly temperatures for January and July are 1.5°C and 25.1°C, respectively.

Site history: Historically, prairie dogs were common throughout the area, but were exterminated by the early 1970’s (John Ford, United States Department of Agriculture Wildlife Services, personal communication). Gunnison’s prairie dogs began to re-colonize the study site from adjacent private land in 1998. During our study, the colony occurred within a 5 ha area, near the base of the Los Piños Mountains in an area with deep clayey loam soils. The site has been long inhabited by kangaroo rats, and represents typical northern Chihuahuan Desert grassland

North Coordinate:34.406954
South Coordinate:34.406954
East Coordinate:106.606269
West Coordinate:106.606269


 

Effect of Habitat Restoration on Native Bee Communities at the Bosque del Apache National Wildlife Refuge, New Mexico (2008-2010)

Abstract: 

Native bees interact closely with their host plants and therefore, can be good indicators of habitat diversity and health. Due to the physical aspects of tamarisk removal, reintroduction of native vegetation (through seeding or natural recolonization) is a process that can take years to stabilize. The soil has been greatly disturbed and the recruitment of reproductively mature plants and therefore, the creation of a healthy seed bank takes time. Many types of adult insects, such as bees, wasps, flies, and beetles, use nectar as a source of energy. However bees dont just drink nectar, they also use the pollen as a source of nutrition on which to rear their offspring. Tamarisk is an incredibly good source of nectar, but is a lousy source of pollen. Since it is wind pollinated, the pollen grains are small and not very nutritious. Insect pollinated plants on the other hand provide both nectar and nutritious pollen. Many of these plants also have very tight relationships with their respective bees, in which case one species of bee may only pollinate a single genus of plant. Bees can be used to monitor the recovery of areas where tamarisk has been removed. The diversity of bees can vary greatly temporally and spatially. Bee traps are a low maintenance and low time commitment way of monitoring bees in xeric systems.

Core Areas: 

Data set ID: 

215

Keywords: 

Methods: 

Bee Traps

Buchmann funnel traps were used to collect the bees.  These traps consist of a 1 at paint can with an automotive funnel that has been sawed off to make the opening wider and then spray painted flourescent blue or flourest yellow.  Two inches of propylene glycol was used in each trap to preserve the specimens.  

Study Design 

The traps were set haphazardly within the center of each habitat type at least 500m from the edge of the habitat type and then as far apart from each other within the habitat type.  There were three traps of each color (yellow and blue) at each habitat type.  

Collecting Bee Traps

Walk to each trap with a notebook and pencil, a hammer, a strainer, forceps, and a large plastic cup. In the notebook, record the date and any problems that occur.

At each trap, place the strainer over the plastic cup and pour the contents of the trap through the strainer, catching the specimens. If some specimens remain in the trap, pour the antifreeze back in the trap and repeat the process. A good swirl usually helps get everything out. Pour the clean antifreeze back in the trap can (paint can) and use the hammer to seal the lid. Place the trap can and the funnel back in the chicken wire cage. Put the specimens from the strainer into a vial filled with 70% EtOH and a label with the dates of collection and the trap number.

Opening the traps

Walk to each trap and open the paint can. Make sure there is at least one inch of antifreeze in the bottom of the trap. Place the funnel in the trap and close the chicken wire. If it has rained and the antifreeze has been watered down, you must empty the old antifreeze into the container and label it as used. Put an inch of fresh antifreeze in the can. Watered down antifreeze will rot along with the specimens. You will notice an especially sweet smell if this is happening. If the color of the funnel is faded, refresh the paint and put in the paint can. It should dry quickly.

Processing the samples

In the lab, all insects from each vial are pinned and labelled (excluding soft bodied insects, ants and small headed flies). Bees are identified to species and all others to order, family or genus. Specimens are to be accessioned into the Museum of Southwestern Biology except for a small reference collection to be given to Bosque del Apache's Visitor Center for public education.

Data sources: 

sev215_bosquebees_20140128.txt
sev215_beespecistlist_20140119.txt

Maintenance: 

Data has not yet been entered.

Quality Assurance: 

Data has not yet been processed.

Additional information: 

Additional Information on the Data Collection Period

Traps are run two weeks out of every month from March through October. This is expected to be a three year study with the potential to repeat the study in 2018-2020.

Additional Study Area Information

Study Area Name: Bosque del Apache NWR.

Study Area Location: This 57,191 acre refuge straddles the Rio Grande Valley in Socorro County, New Mexico.

Small Mammal Exclosure Study (SMES) Surface Soil Disturbance in the Chihuahuan Desert Grassland and Shrubland at the Sevilleta National Wildlife Refuge, New Mexico (1995-2005)

Abstract: 

The purpose of this study is to determine whether or not the activities of small mammals regulate plant community structure, plant species diversity, and spatial vegetation patterns in Chihuahuan Desert shrublands and grasslands. What role if any do indigenous small mammal consumers have in maintaining desertified landscapes in the Chihuahuan Desert? Additionally, how do the effects of small mammals interact with changing climate to affect vegetation patterns over time?

This is data for animal created soil surface disturbance measured from each of the SMES study plots. Soil surface disturbance was measured from each of the 36 one-meter2 quadrats twice each year when vegetation was measured.

Core Areas: 

Data set ID: 

99

Additional Project roles: 

127
128
129
130

Keywords: 

Purpose: 

The purpose of this study is to determine whether or not the activities of small mammals regulate plant community structure, plant species diversity, and spatial vegetation patterns in Chihuahuan Desert shrublands and grasslands. What role if any do indigenous small mammal consumers have in maintaining desertified landscapes in the Chihuahuan Desert? Additionally, how do the effects of small mammals interact with changing climate to affect vegetation patterns over time? This study will provide long-term experimental tests of the roles of consumers on ecosystem pattern and process across a latitudinal climate gradient. The following questions or hypotheses will be addressed.

1) Do small mammals influence patterns of plant species composition and diversity, vegetation structure, and spatial patterns of vegetation canopy cover and biomass in Chihuahuan Desert shrublands and grasslands? Are small mammals keystone species that determine plant species composition and physiognomy of Chihuahuan Desert communities? Do small mammals have a significant role in maintaining the existence of shrub islands and spatial heterogeneity of creosotebush shrub communities?  

2) Do small mammals affect the taxonomic composition and spatial pattern of vegetation similarly or differently in grassland communities as compared to shrub communities? How do patterns compare between grassland and shrubland sites, and how do these relatively small scale patterns relate to overall landscape vegetation patterns?

3) Do small mammals interact with short-term (annual) and  long-term (decades) climate change to affect temporal changes in vegetation spatial patterns and species composition?

4) Do small mammals interact with other herbivore and granivore consumers enough to affect the species composition and abundance’s of other consumers such as ants and grasshoppers?

Data sources: 

sev099_smesdisturb_02232011.txt

Methods: 

Experimental Design:

There are 2 study sites, the Five Points grassland site, and the Rio Salado creosotebush site. Each study site is 1 km by 0.5 km in area. Three rodent trapping webs and four replicate experimental blocks of plots are randomly located at each study site to measure vegetation responses to the exclusion of small mammals. Each block of plots is 96 meters on each side. Each block of plots consists of 4 experimental study plots, each occupying 1/4 of each block. The blocks of study plots are all oriented on a site in a X/Y coordinate system, with the top to the north. Treatments within each block include one unfenced control plot (Treatment: C), one plot fenced with hardware cloth and poultry wire to exclude rodents and rabbits (Treatment: R), and one plot fenced only with poultry wire to exclude rabbits (Treatment: L). The three treatments were randomly assigned to each of the four possible plots in each block independently, and their arrangements differ from block to block. Each of the three plots in a replicate block are separated by 20 meters.

Each experimental measurement plot measures 36 meters by 36 meters. A grid of 36 sampling points are positioned at 5.8-meter intervals on a systematically located 6 by 6 point grid within each plot. A permanent one-meter by one-meter vegetation measurement quadrat is located at each of the 36 points. The 36 quadrats are numbered 1-36, starting with number 1 in the top left corner (north-west) of each plot (top being north), and running left (west) to right (east), then down (south) one row, and then right (east) to left (west), and so on Quadrat/rebar number one is in the northwest corner of each plot, and numbers 1-6 are across the north side of the plot west to east, then quadrat/rebar number 7 is just south of quadrat/rebar number 6, and rebar numbers increase 7-12 east to west, and so on. 3-inch nails were originally placed in the top left (north-west) corner of each quadrat. These may be difficult to see. A 3-meter wide buffer area is situated between the grid of 36 points and the perimeter of each plot.

While measuring vegetation on each quad, soil surface disturbances identified by what animal caused the disturbance was measured. The same method as measuring plant cover from the vegetation measurement frame was used. The soil surface disturbance as portions of the 10cm by 10cm grid squares was measured using the maximum depth/height of each disturbance type.

Maintenance: 

07/10/03  - Checked data for missing data points, doubles, and errors.  Missing data points were recorded using periods (.), duplicates of data points were removed, and errors were corrected.  If a data point contained a measurement of zero and a measurement with an observation, the zero observation was removed.

- Missing all plots for BLOCK 1 at the Grassland Site for the spring except BLOCK 1 PLOT 1 TRT L.  Other plots that are missing from the Grassland Site in the spring are BLOCK 2 PLOT 3 TRT C, BLOCK 3 PLOT 3 TRT R, and BLOCK 4 PLOT 2 TRT C. All plots are present for the fall, but several data points are missing.

- Removed Species, Comments, and Per fields.  Tape field was changed to ID#. If there were no observations made in the previously named Tape field, observations from the Per field were moved to the new ID# field.  EC field was added and NA was recorded in this field for this year and any comments made were put in this field.  Date MM/DD/YY field was changed to just DATE. Other changes in the fields include PLT to PLOT, BLK to BLOCK, SPECIES to SD, COV to COVER, and HT to DEPTH.

- All quads for this year originally had AD recorded as the soil disturbance seen.  This is an unknown code. The comments field contained actual soil disturbance codes.  AD was removed and replaced with the soil disturbance codes found in the comments field.

- Negative values in the depth field were given their absolute  value.

- Several quads contained AB for soil disturbance.  This is an unknown code. AB was changed to AH, arthropod hole, because 1996 data had AB also and stated it was an arthropod burrow.  We currently use AH to identify all arthropod holes. Also, ‘originally AB’ was recorded in the EC field for these data points. A few quads had RT, an unknown code, recorded for soil disturbance.  Changed RT to UD and ‘originally RT’ was recorded in the EC field.  Any similar corrections were dealt with in the same manner.

- Any data points that had a zero value in cover field were categorized  SD, which is used when there is no soil disturbance present, and the depth field was given a zero value.

- Any empty cells were filled in with either a period for missing data or an NA for not applicable.

- Terri Koontz

07/14/03  - Modified metadata to correct format.

- Terri Koontz

07/21/03  - Spring Field Season Changes

For Grass Site BLOCK 2 PLOT 1 TRT L, there were two observations for most quads that had different dates (05/02/95, 05/03/95, and 05/04/95).  All data points with either 05/02/95 or 05/03/95 were changed to BLOCK 1 PLOT 1 TRT L.  This was done because one other plot for BLOCK 2 had some quads with this same date.  Also, it seemed logical that BLOCK 1 would have been measured first.

- Terri Koontz

7/23/03   - Changed data to fit parameters.  For example if a measurement was 0.25 it was rounded to the closest 0.1 value, which in this case is 0.3.  Also, if there was a measurement less than 0.05 these were rounded up to 0.1 to show that an occurence was present.  See 'Variable Descriptions' Variable 8.

- Terri Koontz

07/10/03  - Checked data for missing data points, doubles, and errors. Missing data points were recorded using periods (.), duplicates of data points were removed, and errors were corrected.  If a data point contained a measurement of zero and a measurement with an observation, the zero observation was removed.

- Removed Comments and Per fields.  Tape field was changed to ID#. If there were no observations made in the  previously named Tape field, observations from the Per field were moved to the new ID# field.  EC field was added and NA was recorded in this field for this year and any comments made were put in this field.  Date MM/DD/YY field was changed to just DATE. Other changes in the fields    include PLT to PLOT, BLK to BLOCK, SPECIES to SD, COV to COVER, and HT to DEPTH.

- AB, arthropod burrow, was changed to AH, arthropod hole, which is the current code we use for this type of  disturbance.

- For Fall at the Creosote Site BLOCK 4 PLOT 2 TRT C QUAD 3, deleted first observation of DT which had the same measurements as the second obs., but it had a height of 1. 

- Any data points that had a zero value in the cover field  and were categorized SD were given a zero value in the depth field.

- Any empty cells were filled in with either a period for missing data or an NA for not applicable.

- Terri Koontz

07/14/03  - Modified metadata to correct format.

- Terri Koontz

07/10/03  - Checked data for missing data points, doubles, and errors.  Missing data points were recorded using periods (.), duplicates of data points were removed, and errors were corrected.  If a data point contained a measurement of zero and a measurement with an observation, the zero observation was removed.

- Date MM/DD/YY field was changed to just DATE.

- Missing plots are Site G BLOCK 1 PLOT 2 TRT R and Site G BLOCK 2 PLOT 1 TRT L.  These plots are from the fall field Season.  All plots are present for spring field season.

- Quads 10-16 were originally classified as TRT C in the fall at the Grass Site for BLOCK 4 PLOT 1.  Changed the TRT to TRT R.

- For the fall field season at the Grass Site, BLOCK 2 PLOT 4 TRT R QUADS 7 and 8 were classified as Creosote, changed to Grass Site. 

- Any data points that had a zero value in the cover field  and were categorized SD were given a zero value in the depth field.

- Any empty cells were filled in with either a period for missing data or an NA for not applicable.

- Terri Koontz

07/14/03  - Modified metadata to correct format.

- Terri Koontz

07/23/03  - Changed data to fit parameters.  For example if a measurement was 0.25 it was rounded to the closest 0.1 value, which in this case is 0.3.  Also, if there was a measurement less than 0.05 these were rounded up to 0.1 to show that an occurence was present.  See 'Variable Descriptions' Variable 8.

 - Terri Koontz

07/29/03  – For fall at the Grass Site BLOCK 1 PLOT 4 TRT C QUADS 10-18 had double observations.  For one set of observations, the BLOCK was changed to BLOCK 3.  This was determined by looking at another year for vegetation data to see which set had similar values and species composition for BLOCK 3.

- Terri Koontz

07/10/03  - Checked data for missing data points, doubles, and errors.  Missing data points were recorded using periods (.), duplicates of data points were removed, and errors were corrected.  If a data point contained a measurement of zero and a measurement with an observation, the zero observation was removed.

- Date MM/DD/YY field was changed to just DATE.

- Any empty cells were filled in with either a period for missing data or an NA for not applicable.

- Quads 21-24 were originally classified as TRT C in the spring at the Grass Site for BLOCK 4 PLOT 3, changed the TRT to TRT L.

- Quads 10-17 were originally classified as TRT C in the spring at the Creosote Site for BLOCK 2 PLOT 2, changed the TRT to TRT L.

- All occurrences of one soil disturbance type, AD (arthropod dig), were moved from the vegetation file to the soil disturbance file for this year.  AD was changed to AH, arthropod hole, which is the current code we use for this type of soil disturbance. 

- Terri Koontz

07/14/03  - Modified metadata to correct format.

- Terri Koontz

07/23/03  - Changed data to fit parameters.  For example if a measurement was 0.25 it was rounded to the closest 0.1 value, which in this case is 0.3.  Also, if there was a measurement less than 0.05 these were rounded up to 0.1 to show that an occurence was present.  See 'Variable Descriptions' Variable 8.

- Terri Koontz

07/30/03  - Quads 11-14 were originally classified as TRT C in the spring at the Creosote Site for BLOCK 3 PLOT 4, changed TRT to TRT L.

- Quad 22 for the Grass Site BLOCK 4 PLOT 1 TRT R, was originally classified as TRT C, changed to TRT R.

- Terri Koontz

07/10/03  - Checked data for missing data points, doubles, and errors. Missing data points were recorded using periods (.), duplicates of data points were removed, and errors were corrected.  If a data point contained a measurement of zero and a measurement with an observation, the zero observation was removed.

- Date MM/DD/YY field was changed to just DATE.

- Any empty cells were filled in with either a period for missing data or an NA for not applicable.

- All occurrences of one soil disturbance type, AH (arthropod hole), were moved from the vegetation file to the soil disturbance file for this year.

- Spring Field Season Changes 

For BLOCK 1 PLOT 2 TRT R and BLOCK 2 PLOT 1 TRT L all quads classified as Creosote Site, changed to Grass Site.

For quads 1-18 at the Creosote Site for BLOCK 2 PLOT 1 TRT C, originally classified as PLOT 4, changed to PLOT 1.

For Creosote Site BLOCK 4 PLOT 2 TRT C: Quads 1-4, 28-36 originally PLOT 1 changed to PLOT 2 Quads 5-19 originally PLOT 3 changed to PLOT 2

- Fall Field Season Changes

For quads 1-18 at the Creosote Site for BLOCK 1 PLOT 4 TRT R, originally classified as PLOT 3, changed to PLOT 4.    

- Terri Koontz

07/14/03  - Modified metadata to correct format.

- Terri Koontz

7/23/03   - Changed data to fit parameters.  For example if a measurement was 0.25 it was rounded to the closest 0.1 value, which in this case is 0.3.  Also, if there was a measurement less than 0.05 these were rounded up to 0.1 to show that an occurence was present.  See 'Variable Descriptions' Variable 8.

- Terri Koontz

07/10/03  - Checked data for missing data points, doubles, and errors.  Missing data points were recorded using periods (.), duplicates of data points were removed, and errors were corrected.  If a data point contained a measurement of zero and a measurement with an observation, the zero observation was removed.

- Date MM/DD/YY field was changed to just DATE.

- Any empty cells were filled in with either a period for missing data or an NA for not applicable.

- All occurrences of one soil disturbance type, AH (arthropod hole), were moved from the vegetation file to the soil disturbance file for this year.

- Spring Field Season Changes

For Grass Site BLOCK 1 PLOT 4 TRT C Quads 1-30, originally classified as BLOCK 2, changed to BLOCK 1.

For Grass Site BLOCK 3 PLOT 4 TRT C, originally classified as BLOCK 4 PLOT 3, changed to BLOCK 3 PLOT 4.

- Fall Field Season Changes

For Creosote Site BLOCK 2 PLOT 2 TRT L, date changed from 10/09/00 to 11/09/00 for quads 26-36.

For Grass Site BLOCK 1 PLOT 4 TRT C, date changed from 10/06/00 to 11/06/00 for quads 23-29.         

- Terri Koontz

07/14/03  - Modified metadata to correct format.

- Terri Koontz

7/23/03   - Changed data to fit parameters.  For example if a measurement was 0.25 it was rounded to the closest 0.1 value, which in this case is 0.3.  Also, if there was a measurement less than 0.05 these were rounded up to 0.1 to show that an occurence was present.  See 'Variable Descriptions' Variable 8.

- Terri Koontz

07/14/03  - Modified metadata to correct format.

- Terri Koontz

07/21/03  - Checked data for missing data points, doubles, and errors.  Missing data points were recorded using periods (.), duplicates of data points were removed, and errors were corrected.  If a data point contained a measurement of zero and a measurement with an observation, the zero observation was removed.

- Date MM/DD/YY field was changed to just DATE.

- All occurrences of one soil disturbance type, AH (arthropod hole), were moved from the vegetation file to the soil disturbance file for this year.

- Fall Field Season Changes

Changed dates to reflect that data was measured in 2001 and not in the 1970s.

Changed in the ID# field ‘1’ to SMESVQF01CR1, ‘2’ to SMESVQF01CR2, and ‘3’ to SMESVQF01CR3.

For Creosote BLOCK 2 PLOT 3 TRT R QUADS 34 and 36, originally BLOCK 1 PLOT 3 TRT R, changed BLOCK 1 to BLOCK 2. 

For Grass BLOCK 3 PLOT 4 TRT C, originally recorded as Creosote Site, changed to Grass Site.

For Grass BLOCK 4 PLOT 2 TRT C, originally recorded as Creosote Site, changed to Grass Site.

- Any empty cells were filled in with either a period for missing data or an NA for not applicable.

- Terri Koontz

7/23/03   - Changed data to fit parameters.  For example if a measurement was 0.25 it was rounded to the closest 0.1 value, which in this case is 0.3.  Also, if there was a measurement less than 0.05 these were rounded up to 0.1 to show that an occurence was present.  See 'Variable Descriptions' Variable 8.

- Terri Koontz

03/21/06  - Checked data for missing data points, doubles, and errors. Missing data points were recorded using -999 (human Error), duplicates of data points were removed, and errors were corrected.  If a data point contained a measurement of zero and a measurement with an observation, the zero observation was removed.

- Date MM/DD/YY field was changed to just DATE. BLOCK field was changed to BLK.

- Changed dates to reflect that data was measured in 2002 and not in the 1970s or 1980s.

- Changed to "1" in the EC field with comments.

- Any empty cells were filled in with -999 (human Error) for missing data or an NA for not applicable.- Yang Xia

03/22/06  - For the Spring field season at the Creosote site, Plots missing are BLK 1 Plot 1 Trt C and BLK 3 Plot 3 Trt C. These plots are added to the dataset as missing values.

- Metadata was modified to correct format.

- Yang Xia

03/24/06  - Changed data to fit parameters.  For example if a measurement was 0.25 it was rounded to the closest 0.1 value, which in this case is 0.3.  Also, if there was a measurement less than 0.05 these were rounded up to 0.1 to show that an occurence was present.  See 'Variable Descriptions' Variable 8.

 - changed start date from september 1995 to May 1995 in the research Hypotheses, since the data collection was starting on 05/02/95. 

04/13/06  - added some missing data of AH (arthropod hole) from Terri (ah2002_tk) .

- Yang Xia

05/05/06  - Checked data for missing data points, doubles, and errors.  Missing data points were recorded using -999 (human Error),  duplicates of data points were removed, and errors were corrected.  If a data point contained a measurement of zero and a measurement with an observation, the zero observation was removed.

- Date MM/DD/YY field was changed to just DATE. BLOCK field was changed to BLK.

- Changed dates to reflect that data was measured in 2002 and not in the 1970s.

- Changed to "1" in the EC field with comments.

- Any empty cells were filled in with -999 (human Error) for missing data or an NA for not applicable.

- Yang Xia

06/05/06  - Checked data to fit parameters.  For example if a measurement was 0.25 it was rounded to the closest 0.1 value, which in this case is 0.3.  Also, if there was a measurement less than 0.05 these were rounded up to 0.1 to show that an occurence was present.  See 'Variable Descriptions' Variable 8.

- Metadata was modified to correct format.

- Yang Xia

06/10/06  - Checked data for missing data points, doubles, and errors. Missing data points were recorded using -999 (human Error), duplicates of data points were removed, and errors were  corrected. If a data point contained a measurement of zero and a measurement with an observation, the zero observation was removed.

- Date MM/DD/YY field was changed to just DATE. BLOCK field was changed to BLK.

- Changed dates to reflect that data was measured in 2004 and not in the 1970s OR 1990's.

- Changed to "1" in the EC field with comments.

- Any empty cells were filled in with -999 (human Error) for missing data or an NA for not applicable.

- Yang Xia

06/29/06  - Checked data to fit parameters.  For example if a measurement was 0.25 it was rounded to the closest 0.1 value, which in this case is 0.3.  Also, if there was a measurement less than 0.05 these were rounded up to 0.1 to show that an occurence was present.  See 'Variable Descriptions' Variable 8.

- For Creosote Site in the Spring, changed BLOCK 4 PLOT 1 TRT C QUAD 17-21 to BLOCK 4 PLOT 1 TRL L QUAD 17-21.

- For Grassland in the Spring, changed BLOCK 4 PLOT 1 TRT C QUAD 31-36 TO BLOCK 4 PLOT 1 TRT R QUAD 31-36.

- Metadata was modified to correct format.

- Yang Xia

06/30/06  - Checked data for missing data points, doubles, and errors. Missing data points were recorded using -999 (human Error), duplicates of data points were removed, and errors were  corrected. If a data point contained a measurement of zero and a measurement with an observation, the zero observation was removed.

- Date MM/DD/YY field was changed to just DATE. BLOCK field was changed to BLK. Tapedid was changed to ID#.

- Any empty cells were filled in with -999 (human Error) for missing data, or an NA for not applicable.

- Yang Xia

07/06/06  - Checked data to fit parameters.  For example if a measurement was 0.25 it was rounded to the closest 0.1 value, which in this case is 0.3.  Also, if there was a measurement less than 0.05 these were rounded up to 0.1 to show that an occurence was present.  See 'Variable Descriptions' Variable 8.

- Metadata was modified to correct format.

- An NA for not applicable in the EC field in 2005.

- Yang Xia

Additional information: 

Additional Information on the personnel associated with the Data Collection / Data Processing

Sevilleta Field Crew Employee History

Megan McClung, April 2013-present, Stephanie Baker, October 2010-Present, John Mulhouse, August 2009-Present, Amaris Swann, August 25, 2008-January 2013, Maya Kapoor, August 9, 2003-January 21, 2005 and April 2010-March 2011, Terri Koontz, February 2000-August 2003 and August 2006-August 2010, Yang Xia, January 31, 2005-April 2009, Karen Wetherill, February 7, 2000-August 2009, Michell Thomey, September 3, 2005-August 2008, Jay McLeod, January 2006-August 2006, Charity Hall, January 31, 2005-January 3, 2006, Tessa Edelen, August 15, 2004-August 15, 2005, Seth Munson, September 9, 2002-June 2004, Caleb Hickman, September 9, 2002-November 15, 2004, Heather Simpson, August 2000-August 2002, Chris Roberts, September 2001-August 2002, Mike Friggens, 1999-September 2001, Shana Penington, February 2000-August 2000.

Pino Gate Prairie Dog Study: Landscape-scale Ground-Dwelling Arthropod Plot Data from the Sevilleta National Wildlife Refuge, New Mexico (2000-2001)

Abstract: 

Keystone species have large impacts on community and ecosystem properties, and create important ecological interactions with other species. Prairie dogs (Cynomys spp.), and banner-tailed kangaroo rats (Dipodomys spectabilis) are considered keystone species of grassland ecosystems, and create a mosaic of unique habitats on the landscape. These habitats are known to attract a number of animal species, but little is known about how they affect arthropod communities. Our research evaluated the keystone roles of prairie dogs and kangaroo rats on arthropods at the Sevilleta National Wildlife Refuge in central New Mexico, USA. We evaluated the impacts of these rodents on ground-dwelling arthropod and grasshopper communities in areas where prairie dogs and kangaroo rats co-occurred compared to areas where each rodent species occurred alone. Our results demonstrate that prairie dogs and kangaroo rats have keystone-level impacts on these arthropod communities. Their burrow systems provided important habitats for multiple trophic and taxonomic groups of arthropods, and increased overall arthropod abundance and species richness on the landscape. Many arthropods also were attracted to the aboveground habitats around the mounds and across the landscapes where the rodents occurred. Detritivores, predators, ants, grasshoppers, and rare rodent burrow inhabitants showed the strongest responses to prairie dog and kangaroo rat activity. The impacts of prairie dogs and kangaroo rats were unique, and the habitats they created supported different assemblages of arthropods. Where both rodent species occurred together on the landscape, there was great habitat heterogeneity and increased arthropod diversity.

Core Areas: 

Data set ID: 

195

Additional Project roles: 

347
348

Keywords: 

Data sources: 

sev195_pdogarthroplot_01132009.txt

Methods: 

Experimental Design

We compared the ground-dwelling arthropods on plots occupied by: 1) both species (Pdog+Krat plot); 2) only kangaroo rats (Krat plot); and 3) both species, but where prairie dogs inhabited one half of the plot and kangaroo rats inhabited the other half (Transition plot).

Sampling Design

The landscape-scale plots were 180 m x 180 m. On each landscape-scale plot, pitfall traps were installed using a 5 x 5 grid array and placed at 30 m intervals along each transect line.

Field methods

The pitfall traps were made of 10 oz plastic cups inserted into 12 oz cans, buried with the rim of the cup flush with the ground. Traps were filled with non-toxic propylene glycol as the trapping and preservation agent, and ceramic tiles (0.23 m x 0.23 m) were elevated over the traps. Traps were opened for one month, both during spring (May) and fall (September), from spring 2000 through fall 2001.

Laboratory Procedures

Arthropod samples were sorted and identified in the laboratory. Only ground-dwelling taxa were considered. The pitfall dataset resulted in 218 species (from both plot and mound samples). Most taxonomic groups were identified to species, but weevils (Curculionidae), velvet ants (Mutillidae), and spider wasps (Pompilidae) were grouped at higher taxonomic levels and not included in species richness analyses. Nymphs of crickets, grasshoppers, and spiders could not be identified to species. Arthropod voucher specimens from this study were deposited in the collection of the Arthropod Division, Museum of Southwestern Biology (MSB) at the University of New Mexico (UNM).

Maintenance: 

1/09/2009 -YX. The metadata was entered by Yang Xia from metadata supplied by Ana Davidson
1/17/2008 (Yang Xia) - updated and modified metadata to correct format; - Checked data for missing data points and errors

Additional information: 

Additional Personnel in Collecting Data/Samples

Julie McIntyre assisted in field data collection.

Additional Study Area Information

Study Area Name: Pino Gate

Study Area Location: The study site was located near the base of the Los Pinos mountains and directly adjacent to the
nothern fencline of the SNWR at Pino Gate

Elevation: 1600 m

Vegetation: Burrograss (Scleropogon brevifolius), sand dropseed (Sporobolus ryptandrus), and black grama
(Bouteloua eriopoda) were the dominant vegetation.

Soils: Deep clayey loam soils

Geology: On an upper bajada slope, in a broad swale

Climate: Long-term mean annual precipitation is 243 mm, about 60% of which occurs during the summer. Long-term mean monthly temperatures for January and July are 1.5°C and 25.1°C, respectively.

Site history: Historically, prairie dogs were common throughout the area, but were exterminated by the early 1970’s (John Ford, United States Department of Agriculture Wildlife Services, personal  communication). Gunnison’s prairie dogs began to re-colonize the study site from adjacent private land in 1998. During our study, the colony occurred within a 5 ha area, near the base of the Los Piños Mountains in an area with deep clayey loam soils. The site has been long inhabited by kangaroo rats, and represents typical northern Chihuahuan Desert grassland

North Coordinate:34.406954
South Coordinate:34.406954
East Coordinate:106.606269
West Coordinate:106.606269

Investigating Host Feeding Strategy as a Determinant of Insect Gut Microbial Community Profile at the Sevilleta National Wildlife Refuge, New Mexico

Abstract: 

Diverse microbial communities live in the gut regions of animals. The precise ecological and evolutionary circumstances that govern relationships between hosts and their gut communities is unclear. In this study, we hypothesize that host feeding strategy shapes the microbial communities within the gut systems of insects. We collected five insect species from the Sevilleta National Wildlife Refuge that exhibited herbivorous, detritovorous and carnivorous diets. Using gut samples from the insects we measured if and how microbial communities are shaped based on any effect host feeding strategy might have. Preliminary analysis of bacterial communities using 16S rDNA sequences has thus far revealed that the sampled community profiles initially appear to show signs of being determined by host feeding type. Analysis has also shown that sequences from the phyla Firmicutes and Proteobacteria appear to contribute most significantly to the differences between communities of different feeding types. We expect that upon further data recovery, the extent of the effect host feeding type has on the communities will be clarified. Additionally we intend to incorporate bacterial community data from previous studies to further broaden our sample set. We expect our results to further define the ecological circumstances that shape the microbial populations within living systems.

Data set ID: 

226

Core Areas: 

Additional Project roles: 

16
17

Keywords: 

Methods: 

DNA Extraction, PCR Amplification & Sequencing: 

Total community DNA was extracted for each intestinal sample by using the phenol-choloroform method with ethanol precipitation. Bacterial 16S rRNA genes were amplified from the community DNA with the bacteria-specific forward primer 8F 5’AGAGTTTGATCCTGGCTCAG 3’ and the reverse primer 1391R 5’ GACGGGCGGTGTGTRCA 3’. PCR amplification was performed in 50 ul reactions containing 5 ul 10X buffer (Promega Buffer B w/ 1.5 mM MgCl2 ), 12.5 mM concentration of each dNTP (BioLine USA Inc.), 20 pmol of each forward and reverse primer, 2.5 U Taq polymerase (Promega, US), and approximately 150 ng of DNA. The PCR thermal cycling program consisted of 30 cycles at 30s at 94oC, 30s at 50oC and 90s at 72oC. Amplified 16S rRNA genes were spin purified using a DNA purification kit (MoBio Laboratories) and cloned using the TOPO TA Cloning Kit (Invitrogen), according to manufacturer’s instructions. Clones were sequenced using 8F primers.

Sequence Analysis: 

16S rRNA gene sequence data was screened for quality using CodonCode Aligner (CodonCode Corporation). High quality sequences of length greater than 500 bp were then exported for further analysis.

Sampling Design:

Five coleopterans were chosen based on availability at sampling time (September 13-20 of 2008). Three individuals were collected for each species, all from the Nunn Flats area of the Sevilleta NWR. Coleopterans were chosen based on observed or known feeding habits. Samples were collected alive and placed in plastic bags and stored on ice. Samples were then stored in freezer upon arrival at the lab and processed within 48 hours.

Sample Processing: 

Samples were dissected using sterile technique. A cut was made along the elytra of the insects, and the intestinal tract entirely removed from the sample. Intestinal tracts were stored in sucrose lysis buffer until DNA was extracted from the samples. After intestine sample removal, insects were stored in 95% ethanol and identified and vouchered at the Museum of Southwest Biology at UNM.

Data sources: 

sev226_gutmicrobialcommunity_20140114.csv

Additional information: 

Subscribe to RSS - arthropods